Haplogroup R2

From Infogalactic: the planetary knowledge core
Jump to: navigation, search
Haplogroup R2
R2, Y-DNA haplogroup.jpg
Possible time of origin 12,000 ybp
Possible place of origin South Asia
Ancestor Haplogroup R
Descendants Haplogroup R2a
Defining mutations M479
Highest frequencies South Asia

Haplogroup R2, or haplogroup R-M479, is a Y-chromosome haplogroup characterized by genetic marker M479. It has been concentrated geographically in South Asia since prehistoric times.

Subclades

Haplogroup R2
Paragroup R-M479*

  Haplogroup R2a

 


Paragroup R-M479*

Paragroup is a term used in population genetics to describe lineages within a haplogroup that are not defined by any additional unique markers. They are typically represented by an asterisk (*) placed after the main haplogroup.

Y-chromosomes which are positive to the M479 SNP and negative to the M124, P249, P267, L266, PAGES00004, and L381 SNPs, are categorized as belonging to Paragroup R-M479*. It should be noted that exclusive studies have not been done to determine frequency or presence of R-M479* and figures below are not indicative of R-M479* frequency, especially within South Asia since Pakistan is the only South Asian country included within the referenced study.

Frequency of Paragroup R-M479* (M479+, M124-)
Count Sample size R-M479* Frequency
Portugal, Lisbon 1 100 0.010
Andalusia, Sevilla 1 127 0.008
Bashkirs (Bashkortostan, Russia) 1 39 0.026
Italy North 1 124 0.008
Ossetian South (South Caucasus) 1 23 0.043
Pakistan North 6 85 0.071

Haplogroup R-M124

Haplogroup R-M124 is a Y-chromosome haplogroup characterized by genetic markers L266, M124, P249, and P267, and is mainly found in South Asia and southern Central Asia.

Position on the ISOGG tree and related SNPs

Haplogroup R2 is a subgroup of Haplogroup R (M207):

  • R-M207 (M207)
    • R-M306 (M306)
    • R-M173 (M173)
    • R-M479 (M479)
      • R-M124 (M124, P249, P267, L266)
        • R-L295 (L295)
        • R-L263 (L263)
        • R-L1069 (L1069)

Description of the M479 SNP

Common Name Marker M479
YCC Haplogroup R-M479
Nucleotide change C to T
Amplicon size (bp) reference sequence 323
Polymorphism position from 5' end 107
Restriction enzyme variant HphI
RefSNP ID -
Y-position 19294055
Primer forward 5'-3' gatactttatcaggcttacttc
Primer reverse 5'-3' aaccaaatctctcagaatcg

Notes

See also

Y-DNA R-M207 subclades

<templatestyles src="Div col/styles.css"/>

3

Y-DNA backbone tree

Evolutionary tree of human Y-chromosome DNA haplogroups [χ 1][χ 2]
"Y-chromosomal Adam"
A00 A0-T [χ 3]
A0 A1[χ 4]
A1a A1b
A1b1 BT
B CT
DE CF
D E C F
F1 F2 F3 GHIJK
G HIJK
H IJK
IJ K
I J LT [χ 5]  K2
L T NO [χ 6] K2b [χ 7]   K2c K2d K2e [χ 8]
N O K2b1 [χ 9]    P
M S [χ 10] Q R
  1. ↑ Lua error in package.lua at line 80: module 'strict' not found.
  2. ↑ International Society of Genetic Genealogy (ISOGG; 2015), Y-DNA Haplogroup Tree 2015. (Access date: 1 February 2015.)
  3. ↑ Haplogroup A0-T is also known as A0'1'2'3'4.
  4. ↑ Haplogroup A1 is also known as A1'2'3'4.
  5. ↑ Haplogroup LT (L298/P326) is also known as Haplogroup K1.
  6. ↑ Haplogroup NO (M214) is also known as Haplogroup K2a (although the present Haplogroup K2e was also previously known as "K2a").
  7. ↑ Haplogroup K2b (M1221/P331/PF5911) is also known as Haplogroup MPS.
  8. ↑ Haplogroup K2e (K-M147) was previously known as "Haplogroup X" and "K2a" (but is a sibling subclade of the present K2a, also known as Haplogroup NO).
  9. ↑ Haplogroup K2b1 (P397/P399) is similar to the former Haplogroup MS, but has a broader and more complex internal structure.
  10. ↑ Haplogroup S (S-M230) was previously known as Haplogroup K5.

External links

es:Haplogrupo R2 ADN-Y ru:Гаплогруппа R2 (Y-ДНК)

Retrieved from "https://infogalactic.com/w/index.php?title=Haplogroup_R2&oldid=697772308"